FlowerPersonKittyCat
FlowerPersonKittyCat FlowerPersonKittyCat
  • 01-07-2021
  • Mathematics
contestada

Pls help on 1 and 2. I have no idea what I'm supposed to do.

Pls help on 1 and 2 I have no idea what Im supposed to do class=

Respuesta :

footballtom93 footballtom93
  • 02-07-2021
What he said because. And so yea
Answer Link
kamislamee27
kamislamee27 kamislamee27
  • 07-07-2021
Im lost dude someone help
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How did the triple alliance and the triple entente change during the war?
Why were senators able to amass more power and influence than congressmen during the gilded age?
Name the five transport mechanisms of the cell:
The long-reigning absolutist king of france, __________, portrayed himself as the "sun king."
Why were senators able to amass more power and influence than congressmen during the gilded age?
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
CAN SOMEONE HELP ME WITH THIS PLEASE ??
Tell what whole number you can substitute for x in the following list so the numbers are ordered from least to greatest. 2/x ,x/6, 70%
what are the zeros of the polynomial x2+4x-12