jenniibanez993 jenniibanez993

03-10-2021
Mathematics

contestada

Write the standard form of the equation of the line through the given points. through: (-2,3) and (-1,-1)

Respuesta :

evecamargo evecamargo

03-10-2021

Answer:

4x-y=-5

Step-by-step explanation:

Answer Link

Otras preguntas

What is the area of this composed figure

who invented the theory of relativity

_____design in construction engineering may show that you need to excavate at the construction site before you can buildA. TopographicalB. GeographicalC. Geol

What is the value of x?

Business contracts or marriage licenses are found in which stage of relational development

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What’s the answer to #12? and why

what is the theoretical probability of picking a diamond from a standard deck of car

You are on standby at a sporting event when an infant nearby suddenly begins to cough

N general, emerging adulthood is a time during which a person functions physically and psychologically at an optimal level.