garciakristine0202 garciakristine0202
  • 01-11-2021
  • English
contestada

Ano ang kaibahan ng mga akda ni Amado Hernandez kay Bienvenido Ramos? Magbigay ng mga salitang naghahayag sa linya tula ng mga “panghihinayang at hinanakit ” sa kanilang mga akda.

Respuesta :

benhandy28 benhandy28
  • 01-11-2021
basically it says that you need to bienvendio ramos
Answer Link

Otras preguntas

Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Did feudalism create a stable form of government?
What are the factors of 6x + 24?
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Tu as quels cours le jeudi matin?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please help solve, thanks in advance!
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be