incamjrose incamjrose
  • 04-01-2017
  • Social Studies
contestada

The __________ principle is that, in a democracy, policies should reflect the will of more than half of the voters.

Respuesta :

Аноним Аноним
  • 04-01-2017
Answer would be majority rule
Answer Link

Otras preguntas

Use Lagrange multipliers to find the maximum and minimum values of the function subject to the given constraint. (If an answer does not exist, enter DNE.) f(x,
Zilly Co. predicts sales of $176,000 for June. Zilly pays a sales manager a monthly salary of $6,900 and a commission of 7% of that month’s sales dollars. Prepa
will give brainlest Fill in the blank with the correct form of the adjective in parenthesis. Hay muchos pájaros ___________ (rojo) aquí. its not rojo or roja
I don’t know how to do it and I need help
What is the slope indicated in the table below
Bay City uses the purchases method to account for supplies. At the beginning of the year the city had no supplies on hand. During the year the city purchased $6
The number of women graduating from​ 4-yr colleges in a particular country grew from 1930​, when 48,833 women earned a​ bachelor's degree, to 2004​, when approx
Please help!!! 2x²-5x-12 (quadratic equations) Explain your work and describe the solution. I really appreciate it!
A distant large asteroid is detected that might pose a threat to Earth. If it were to continue moving in a straight line at constant speed, it would pass 24000
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template