cakeofthecookie cakeofthecookie
  • 01-03-2022
  • SAT
contestada

If f(3x) = x - 6, then what is f(6)?

An explanation would be very helpful, thank you!!!

Respuesta :

bitxhking1 bitxhking1
  • 03-03-2022

Answer:

What are the four core areas of a social enterprise?

Explanation:

Major areas include: public and nonprofit management, corporate social responsibility / sustainability, international development, and social entrepreneurship. A further breakdown of these areas is provided below.

Answer Link

Otras preguntas

what are 2 points on the graph for 6x-5y=25
The Panama Canal connects what two bodies of water?
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what might be learned from an incorrect hypothesis
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
Graph the first six terms of a sequence where a1 = -10 and d = 3.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?