isabellacampos7450 isabellacampos7450
  • 04-03-2022
  • Biology
contestada

How does a flaccid cell differ from a turgid cell?.

Respuesta :

teayrieugene teayrieugene
  • 04-03-2022
Flaccid cell has a lower pressure point.

….In turgidity, a plant cell appears swollen or distended from the turgor pressure put on the cell wall whereas in flaccidity the plant cell loses it and appears limp or flaccid
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Which word has the long i sound? relieve speciality society social
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
Graph the first six terms of a sequence where a1 = -10 and d = 3.
Why were the committees of correspondence powerful?
How do I do trebuchet calculations????? Help me please
the bombing of Hiroshima and Nagasaki resulted in