rishavhades rishavhades
  • 04-04-2022
  • Mathematics
contestada

find the volume for the shape below

find the volume for the shape below class=

Respuesta :

dylan2548 dylan2548
  • 04-04-2022
30in I know that because I just did this .this is EASY!
Answer Link

Otras preguntas

behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false
what is x? using the picture below and directions
A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.
Find the missing length indicated
Fill in each blank with mitosis or meiosis. humans produce gametes by the process of __________________. a zygote becomes a fetus by the process of_____________
If XY=18, YZ=14, and XZ=20, find the radius of each circle.
You can calculate triangle area when you know all three sides by using Heron's Formula. You can also use a formula discovered by the Chinese which I found in W
what is the scale factor of a cube with a volume of 343 m^3 to a cube with a volume of 5'832 m^3?