davinioza davinioza

04-07-2017
Mathematics

contestada

Find the y-intercept for the line represented by this equation.

Find the yintercept for the line represented by this equation class=

Respuesta :

victoriatharpe02 victoriatharpe02

04-07-2017

it would be B because you have to divide both sides by -2 to isolate the y !

Answer Link

04-07-2017

-2y = 4(0) +8
-2y = 0 +8
( -2y = 8 ) /-2
y = -4
The answer is B. (0, -4).

Answer Link

Otras preguntas

if f(x)=4x-6, what is f(6)

What are some examples of dramatic irony in The Hobbit?

Which of the following shows the graph of y=In(-2x)

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s

What body systems are used to pick up a pencil and write down a few sentences in the space below? Fingers, Hand and arms is not what I’m looking for.

When a molecule can best be represented as a series of resonance forms, each of these forms always contributes to the same degree in the hybrid?

Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

In a survey, a group of students were asked to name their favorite day of the week. There were 8 students who chose “other”. How many students participated? Sa

Which weighs more? a.they both weight exactly the same. b.four protons c.two neutrons and two protons in a helium nucleus?