tamyiah1willia
tamyiah1willia tamyiah1willia
  • 04-02-2018
  • Business
contestada

Silence will operate as acceptance in the following circumstances except:

Respuesta :

Atrey
Atrey Atrey
  • 04-02-2018
Silence will operate as acceptance in the following circumstances except when the offeror indicates that silence will operate as acceptance
Answer Link

Otras preguntas

the perimeter of a square 116ft ?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Help pl0x, Algebra 1
Why did the American public mostly oppose joining the League of Nations after WWI?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
4.2meters= how many centimeter