krogerr13 krogerr13

01-03-2018
Mathematics

contestada

help me find the area pls!! (show me how, don’t give the answer.)

help me find the area pls show me how dont give the answer class=

Respuesta :

maddies2 maddies2

01-03-2018

u add all the sides up

Answer Link

Otras preguntas

Two boys on bicycles start cycling from the same place at the same time. one cyclist travels 15 miles per hour, the other travels 12 miles per hour, if they tra

A guaranteed protection against vague laws is known as which of the following?

Given the parent function of f(x) = x4, what change will occur when the function is changed to f, bracket one half x end bracket? A. Graph opens the same way an

You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

World population is approximately upper p equals 6.4 left-parenthesis 1.0126 right-parenthesis superscript t, with upper p in billions and t in years since 2004

please help if you know, thanks!

zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?

In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per