Astrid13 Astrid13

01-03-2018
Mathematics

contestada

What is the order of 5 x 10^4, 7 x 10^-5, 3 x 10^-9, 8 x 10^4 from least to greatest?

Respuesta :

jessicak jessicak

07-03-2018

5 x 10 ^4, 8 x 10 ^4, 7 x 10 ^ 5, 3 x 10 ^9

Answer Link

Otras preguntas

what is the absolute value of the complex number -4 — √2i

What is true concerning an ecological community? it is a large region of multiple organisms the boundaries, large or small, of a single organism the ecosystem o

On a number line, let point p represent the largest integer value that is less than 407. le point q represent the largest integer value that is less than 68 − .

A number is increased by 50 percent, then the resulting number is decreased by 40 percent. What is the original number if the final number is eight less than th

circadian rhythm refers to

why does the troposphere experience the greatest amount of atmospheric pressure compared to the other atmospheric layers?

9 students can make a poster in 10 hours. How many students should join them so that they all together can make this poster in 6 hours

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

which is the correct way to rewrite the phrase? the house of Molly and Harriet A. Molly's and Harriet's house B. Molly and Harriet's house C. Mollies and Harrie

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used in one serving of soup?