reedgallagher2014 reedgallagher2014
  • 02-03-2018
  • Mathematics
contestada

An elliptical track has a major axis that is 50 yards long and a minor axis that is 44 yards long. Find an equation for the track if its center is (0, 0) and the major axis is the x-axis.

Respuesta :

khaleedfonrose1 khaleedfonrose1
  • 02-03-2018
do It Have a Pictures
Answer Link

Otras preguntas

What are some methods used by Mussolini to rise to power?
2ln(5x)=8 solve for x
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Solve the equation -10 + 3x + 5x = -56 ? ??
a antonym for biosphere
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
how to i do 7/16÷(31/2÷1/2)
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor